Written by Federico Mora on April 23, 2020
We recently submitted a paper describing a new SMT solver for the theory of strings. To celebrate, I thought I'd go on StackOverflow, search for questions related to DNA sequences, and answer some of them using a sequence solver.0
I've just started to learn programming with python. In class we were asked to generate a random DNA sequence, that does NOT contain a specific 6-letter sequence (AACGTT). The point is to make a funtion that always return a legal sequence. Currently my function generates a correct sequence about 78% of the time. How can I make it return a legal sqeuence 100% of the time? Any help is appreciated.
Let's take "generate a random DNA sequence" to mean "generate some DNA sequence" and let's write something like an SMT-LIB1 query to help this student. The first thing we need to do is define2 nucleotides. We'll do this through an enumerated type with members A, C, T, and G.
(declare-datatype Nucleotide (A C T G))
Next we'll declare the variable that we want to solve for: a sequence of nucleotides called DNA1.
(declare-const DNA1 (Seq Nucleotide))
Then we'll assert that DNA1 is at least six nucleotides long (to avoid trivial solutions), and does not contain the sequence AACGTT, as desired. Finally we'll ask the solver to give us a solution. VoilĂ . That's it.
(assert (>= (seq.len DNA1) 6))
(assert (not (seq.contains DNA1 AACGTT)))
(check-sat)
(get-model)
OK I lied. Writing literal sequences is a bit ugly so I snuck a macro in there that builds the literal sequence units and concatenates them all together. Here is the full query.
(declare-datatype Nucleotide (A C T G))
(declare-const DNA1 (Seq Nucleotide))
(define-fun AACGTT () (Seq Nucleotide)
(seq.++ (seq.unit A)
(seq.unit A)
(seq.unit C)
(seq.unit G)
(seq.unit T)
(seq.unit T)))
(assert (>= (seq.len DNA1) 6))
(assert (not (seq.contains DNA1 AACGTT)))
(check-sat)
(get-model)
Running Z33 on this query gives us the answer AAAAAA. Somewhat underwhelming but 100% correct™. On the bright side, we now know enough about the input language to tackle more interesting questions.
I am working with DNA sequences of length 25... [I want] to find a close match defined as wrong (mismatched) at any location, but only one location, and record the location in the sequence. I am not sure how do do this... For example,
AGCCTCCCATGATTGAACAGATCAT
AGCCTCCCATGATAGAACAGATCAT
is a close match with a mismatch at position 13...
A complete solution to this problem would require a loop over the elements of the database. We'll just write an SMT-LIB-like query to find the single position at which two (hard-coded) input DNA sequences differ, if it exists. The full query for the given example (omitting macros) is
(declare-const X (Seq Nucleotide))
(declare-const Y (Seq Nucleotide))
(declare-const m Nucleotide)
(declare-const n Nucleotide)
(assert (= XmY AGCCTCCCATGATTGAACAGATCAT))
(assert (= XnY AGCCTCCCATGATAGAACAGATCAT))
(assert (not (= n m)))
(check-sat)
(get-value ((seq.len X)))
The first block of commands declares two nucleotide sequence variables, X and Y, that we will use to hold sub-sequences of the input DNA sequences. The second block of commands declares two nucleotide variables, n and m, that will hold the pair of nucleotides that differ. The third block asserts that both input DNA sequences begin with X, end with Y, and have some nucleotide—n and m respectively—in between. The fourth block asserts that n and m are different. Finally, the fifth block asks the solver to find a solution and print it (in our encoding, the length of X is the position at which the DNA sequences differ). Z3 quickly returns the correct solution: the position is 13.
sat
(((seq.len X) 13))
If the two input DNA sequences were the same or differed by more than one nucleotide, then Z3 would have returned unsat.
I'd like to get the substrings of long DNA sequences
For example, given:
1/ATCGAAATTCCGGAAGGGGTGG
...
5/ATTATTGTTCACTATTT
the output is to be:
1/TCG - TTCC
...
5/ -
I tried ... but I don't know how to retrieve the order of each result that has appeared in the original sequences. That is, whether TTCC and TCG appear first and second respectively ... Thank you for your insights.
This one is a little more tricky, but we can use a familiar technique to encode it. At a high level, we want to decompose an input DNA sequence into five pieces. The second and fourth pieces will try to match to TCG or TTCC. The first, third, and fifth pieces will hold the rest of the input.
(declare-const X (Seq Nucleotide))
(declare-const M (Seq Nucleotide))
(declare-const Y (Seq Nucleotide))
(declare-const N (Seq Nucleotide))
(declare-const Z (Seq Nucleotide))
(assert (= (seq.++ X M Y N Z) INPUT))
(assert (or (= M TCG) (= M TTCC)))
(assert (or (= N TCG) (= N TTCC) (= N EMPTY)))
(assert (=> (= N EMPTY)
(and (not (seq.contains (seq.++ Y Z) TCG))
(not (seq.contains (seq.++ Y Z) TTCC))
(not (seq.contains X TCG))
(not (seq.contains X TTCC)))))
(check-sat)
(get-value (M (seq.len X)))
(get-value (N (seq.len (seq.++ X M Y))))
More specifically, we declare five variables: X, M, Y, N, Z. The first assertion decomposes the input so that M represents the first match, N represents the second match, and X, Y and Z represent the rest of the input. The second assertion forces M to match to one of TCG and TTCC; the third assertion does the same for N, but allows for it to be empty. Letting N be empty is good because it lets us capture cases where there is only one occurrence of TCG or TTCC, but it is bad because the solver can choose to always match N with the empty sequence. The fourth assertion blocks this: it asserts that N is only empty if there is nothing to match it to. Finally, with the get-value commands, we ask the solver to tell us where TTCC and TCG appear.
Plugging in ATCGAAATTCCGGAAGGGGTGG for INPUT and running Z3 gives us that the first match, N, is TCG at index 1, and that the second match, M, is TTCC at index 7.
sat
((M (seq.++ (seq.unit T)
(seq.unit C)
(seq.unit G)))
((seq.len X) 1))
((N (seq.++ (seq.unit T)
(seq.unit T)
(seq.unit C)
(seq.unit C)))
((seq.len (seq.++ X M Y)) 7))
With ATTATTGTTCACTATTT the solver gives us unsat, since there are no matches.
I think the biggest takeaway is that you can encode a lot of problems using only concatenation and equality.4 When I first searched "dna sequence" on StackOverflow I wasn't expecting it to be so easy to find problems that I could quickly express and solve with Z3. The encodings don't even need regular expressions!5
Maybe one day I'll revisit this post to talk about the sequence logic and how these solvers work. In the meantime, is anyone actually using automated reasoning on DNA sequences? Scalability would surely be an issue.
0. No, you're obsessive!
1. Sequences are not officially part of The Satisfiability Modulo Theories Library.
2. Maybe "declare-datatype" should be "define-datatype" since we're not solving for it.
3. As far as I know The Z3 Theorem Prover is the only publicly available sequence solver.
4. (seq.contains X Y)
is the same as (= X (seq.++ W Y Z))
for fresh W and Z.
5. The sequence solver can handle regular expressions by the way.